38 questions from NEET 2020, 2021, 2022, 2023, 2024, 2025. Answers verified against NTA official keys.
NEET 2025
Which of the following statements about RuBisCO is true?
1It catalyzes the carboxylation of RuBP
2It is active only in the dark
3It has higher affinity for oxygen than carbon dioxide
4It is an enzyme involved in the photolysis of water
NTA Answer: Option 1(final)
NEET 2025
Given below are two statements : Statement I : Fig fruit is a non-vegetarian fruit as it has enclosed fig wasps in it. Statement II : Fig wasp and fig tree exhibit mutual relationship as fig wasp completes its life cycle in fig fruit and fig fruit gets pollinated by fig wasp. In the light of the above statements, choose the most appropriate answer from the options given below :
1Statement I is incorrect but statement II is correct
2Both statement I and statement II are correct
3Both statement I and statement II are incorrect
4Statement I is correct but statement II is incorrect
NTA Answer: Option 3(final)
NEET 2025
Match List I with List II: List I List II A. The Evil Quartet I. Cryopreservation B. Ex situ conservation II. Alien species invasion C. Lantana camara III. Causes of biodiversity losses D. Dodo IV. Extinction Choose the option with all correct matches.
1A-III, B-II, C-IV, D-I
2A-III, B-II, C-I, D-IV
3A-III, B-I, C-II, D-IV
4A-III, B-IV, C-II, D-I
NTA Answer: Option 3(final)
NEET 2025
Read the following statements on plant growth and development. (A) Parthenocarpy can be induced by auxins. (B) Plant growth regulators can be involved in promotion as well as inhibition of growth. (C) Dedifferentiation is a pre-requisite for re-differentiation. (D) Abscisic acid is a plant growth promoter. (E) Apical dominance promotes the growth of lateral buds. Choose the option with all correct statements.
1B, D, E only
2A, B, C only
3A, C, E only
4A, D, E only
NTA Answer: Option 2(final)
NEET 2025
Which are correct: A. Computed tomography and magnetic resonance imaging detect cancers of internal organs. B. Chemotherapeutics drugs are used to kill non-cancerous cells. C. -interferon activate the cancer patients’ immune system and helps in destroying the tumour. D. Chemotherapeutic drugs are biological response modifiers. E. In the case of leukaemia blood cell counts are decreased. Choose the correct answer from the options given below:
1A and C only
2B and D only
3D and E only
4C and D only
NTA Answer: Option 1(final)
NEET 2025
Match List I with List II: List-I List-II A. Chlorophyll a (I) Yellow-green B. Chlorophyll b (II) Yellow C. Xanthophylls (III) Blue-green D. Carotenoids (IV) Yellow to Yellow-orange Choose the option with all correct matches.
1A-I, B-IV, C-III, D-II
2A-III, B-IV, C-II, D-I
3A-III, B-I, C-II, D-IV
4A-I, B-II, C-IV, D-III
NTA Answer: Option 3(final)
NEET 2025
Which one of the following phytohormones promotes nutrient mobilization which helps in the delay of leaf senescence in plants?
1Cytokinin
2Ethylene
3Abscisic acid
4Gibberellin
NTA Answer: Option 1(final)
NEET 2024
How many molecules of ATP and NADPH are required for every molecule of CO fixed in the Calvin cycle? 2
12 molecules of ATP and 3 molecules of NADPH
22 molecules of ATP and 2 molecules of NADPH
33 molecules of ATP and 3 molecules of NADPH
43 molecules of ATP and 2 molecules of NADPH
NTA Answer: Option 4(final)
NEET 2024
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
1promotes apical dominance.
2promotes abscission of mature leaves only.
3does not affect mature monocotyledonous plants.
4can help in cell division in grasses, to produce growth.
NTA Answer: Option 3(final)
NEET 2024
Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO 2 D. ATP E. NADPH Choose the correct answer from the options given below:
1A, B and C only
2B, C and D only
3C, D and E only
4D and E only
NTA Answer: Option 3(final)
NEET 2024
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
1Malic acid → Oxaloacetic acid
2Succinic acid → Malic acid
3Succinyl-CoA → Succinic acid
4Isocitrate → -ketoglutaric acid
NTA Answer: Option 3(final)
NEET 2024
Given below are two statements: Statement I: In C plants, some O binds to RuBisCO, hence CO fixation is decreased. 3 2 2 Statement II: In C plants, mesophyll cells show very little photorespiration while bundle sheath cells do not 4 show photorespiration. In the light of the above statements, choose the correct answer from the options given below:
1Both Statement I and Statement II are true
2Both Statement I and Statement II are false
3Statement I is true but Statement II is false
4Statement I is false but Statement II is true
NTA Answer: Option 3(final)
NEET 2024
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’TACATGGCAAATATCCATTCA5’
15’AUGUACCGUUUAUAGGUAAGU3’
25’AUGUAAAGUUUAUAGGUAAGU3’
35’AUGUACCGUUUAUAGGGAAGU3’
45’ATGTACCGTTTATAGGTAAGT3’
NTA Answer: Option 1(final)
NEET 2023
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1, 6-diphosphate. In the light of the above statements, choose the correct answer from the options given below :
1Both A and R are true but R is NOT the correct explanation of A.
2A is true but R is false.
3A is false but R is true.
4Both A and R are true and R is the correct explanation of A.
NTA Answer: Option 4(final)
NEET 2023
The reaction centre in PS II has an absorption maxima at
1700 nm
2660 nm
3780 nm
4680 nm
NTA Answer: Option 4(final)
NEET 2023
How many ATP and NADPH are required for the synthesis of one molecule of Glucose during Calvin cycle? 2
118 ATP and 12 NADPH 2
212 ATP and 16 NADPH 2
318 ATP and 16 NADPH 2
412 ATP and 12 NADPH 2
NTA Answer: Option 1(final)
NEET 2023
Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period, that leads early seed production?
1Gibberellic Acid
2Zeatin
3Abscisic Acid
4Indole-3-butyric Acid
NTA Answer: Option 1(final)
NEET 2023
Which micronutrient is required for splitting of water molecule during photosynthesis?
1Molybdenum
2Magnesium
3Copper
4Manganese
NTA Answer: Option 4(final)
NEET 2023
Which hormone promotes internode/petiole elongation in deep water rice?
1Kinetin
2Ethylene
32, 4-D
4GA 3
NTA Answer: Option 2(final)
NEET 2023
Match List I with List II : List I List II A. Oxidative decarboxylation I. Citrate synthase B. Glycolysis II. Pyruvate dehydrogenase C. Oxidative phosphorylation III. Electron transport system D. Tricarboxylic acid cycle IV. EMP pathway Choose the correct answer from the options given below :
1A – II, B – IV, C – I, D – III
2A – III, B – I, C – II, D – IV
3A – II, B – IV, C – III, D – I
4A – III, B – IV, C – II, D – I
NTA Answer: Option 3(final)
NEET 2023
Which of the following combinations is required for chemiosmosis?
1Membrane, proton pump, proton gradient, NADP synthase
2Proton pump, electron gradient, ATP synthase
3Proton pump, electron gradient, NADP synthase
4Membrane, proton pump, proton gradient, ATP synthase
NTA Answer: Option 4(final)
NEET 2023
Match List I with List II: List I List II A. Iron I. Synthesis of auxin B. Zinc II. Component of nitrate reductase C. Boron III. Activator of catalase D. Molybdenum IV. Cell elongation and differentiation Choose the correct answer from the options given below:
1A-II, B-III, C-IV, D-I
2A-III, B-I, C-IV, D-II
3A-II, B-IV, C-I, D-III
4A-III, B-II, C-I, D-IV
NTA Answer: Option 2(final)
NEET 2023
Match List I with List II. List I List II A. Vasectomy I. Oral method B. Coitus interruptus II. Barrier method C. Cervical caps III. Surgical method D. Saheli IV. Natural method Choose the correct answer from the options given below:
1A-III, B-IV, C-II, D-I
2A-II, B-III, C-I, D-IV
3A-IV, B-II, C-I, D-III
4A-III, B-I, C-IV, D-II
NTA Answer: Option 1(final)
NEET 2023
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are:
1Corpora quadrigemina and hippocampus
2Brain stem and epithalamus
3Corpus callosum and thalamus
4Limbic system and hypothalamus
NTA Answer: Option 4(final)
NEET 2022
Production of Cucumber has increased manifold in recent years. Application of which of the following phytohormones has resulted in this increased yield as the hormone is known to produce female flowers in the plants :
1Cytokinin
2ABA
3Gibberellin
4Ethylene
NTA Answer: Option 4(final)
NEET 2022
Which one of the following plants does not show plasticity?
1Maize
2Cotton
3Coriander
4Buttercup
NTA Answer: Option 1(final)
NEET 2022
Which one of the following is not true regarding the release of energy during ATP synthesis through chemiosmosis? It involves:
1Reduction of NADP to NADPH on the stroma side of the membrane 2
2Breakdown of proton gradient
3Breakdown of electron gradient
4Movement of protons across the membrane to the stroma
NTA Answer: Option 3(final)
NEET 2022
What amount of energy is released from glucose during lactic acid fermentation?
1Less than 7%
2Approximately 15%
3More than 18%
4About 10%
NTA Answer: Option 1(final)
NEET 2022
What is the net gain of ATP when each molecule of glucose is converted to two molecules of pyruvic acid?
NTA Answer: Option 4(final)
NEET 2021
The first stable product of CO fixation in sorghum is 2
1(iv) (iii) (ii) (i) (1) Phosphoglyceric acid
2(iii) (iv) (ii) (i) (2) Pyruvic acid
3(ii) (i) (iv) (iii) (3) Oxaloacetic acid
4(iii) (iv) (i) (ii) (4) Succinic acid
NTA Answer: Option 3(final)
NEET 2021
Plants follow different pathways in response to SECTION - A environment or phases of life to form different kinds 101. Which of the following statements is not correct? of structures. This ability is called
1Pyramid of numbers in a grassland ecosystem (1) Maturity
2Elasticity is upright.
3Flexibility
4Plasticity (2) Pyramid of biomass in sea is generally inverted.
NTA Answer: Option 4(final)
NEET 2021
The factor that leads to Founder effect in a 123. The site of perception of light in plants during population is : photoperiodism is
1Genetic drift (1) Leaf
2Natural selection (2) Shoot apex
3Genetic recombination (3) Stem
4Mutation (4) Axillary bud
NTA Answer: Option 1(final)
NEET 2021
Which of the following statements is correct ? cambial ring
1Some of the organisms can fix atmospheric Answer (4) nitrogen in specialized cells called sheath cells 138. Plasmid pBR322 has Pstl restriction enzyme site within gene ampR that confers ampicillin resistance.
2Fusion of two cells is called Karyogamy If this enzyme is used for inserting a gene for β-galactoside production and the recombinant
3Fusion of protoplasms between two motile on non-motile gametes is called plasmogamy plasmid is inserted in an E.coli strain (1) It will be able to produce a novel protein with
4Organisms that depend on living plants are dual ability called saprophytes (2) It will not be able to confer ampicillin resistance
NTA Answer: Option 3(final)
NEET 2020
Á‚Á≈˛U∑§ •ê‹ ø∑˝§ ∑ § ∞∑§ ÉÊÈ◊Êfl ◊ ∑§Êÿ¸Œ˝fl SÃ⁄U »§ÊS»§Ê Á⁄U‹ ‡ÊŸÊ ∑§Ë ‚ ÅÿÊ ÄÿÊ „Ê ÃË „Ò? 100. The number of substrate level phosphorylations in one turn of citric acid cycle is :
1ÃËŸ (1) Three
2‡ÊÍãÿ (2) Zero
3∞∑§ (3) One
4ŒÊ (4) Two
NTA Answer: Option 3(final)
NEET 2020
•ÁŸflÊÿ ¸ÃàflÊ •Ê⁄Ò U ¬ÊŒ¬Ê ◊ ©Ÿ∑§ ∑§ÊÿÊ Z ∑§ Áfl ÿ ◊ ÁŸêŸÁ‹Áπà 102. Match the following concerning essential elements and their functions in plants : ∑§Ê ‚È◊ Á‹Ã ∑§ËÁ¡∞ — (a) Iron (i) Photolysis of water (a) ‹Ê „ (i) ¡‹ ∑§Ê ¬˝∑§Ê‡Ê •¬ÉÊ≈UŸ (b) Zinc (ii) Pollen germination (b) Á¡∑ § (ii) ¬⁄Uʪ ∑§Ê • ∑ȧ⁄UáÊ (c) Boron (iii) Required for chlorophyll (c) ’Ê⁄ UÊŸÚ (iii) Ä‹Ê ⁄UÊ Á»§‹ ∑ § ¡Òfl ‚ ‡‹ áÊ biosynthesis ∑ § Á‹∞ •Êfl‡ÿ∑§ (d) Manganese (iv) IAA biosynthesis (d) ◊Ò ªŸË¡ (iv) •Ê߸.∞.∞. ¡Òfl ‚ ‡‹ áÊ Select the correct option : ‚„Ë Áfl∑§À¬ øÈÁŸ∞ — (a) (b) (c) (d) (a) (b) (c) (d)
1(iv) (i) (ii) (iii) (1) (iv) (i) (ii) (iii)
2(ii) (i) (iv) (iii) (2) (ii) (i) (iv) (iii)
3(iv) (iii) (ii) (i) (3) (iv) (iii) (ii) (i)
4(iii) (iv) (ii) (i) (4) (iii) (iv) (ii) (i)
NTA Answer: Option 4(final)
NEET 2020
flÎÁh ∑§Ë ¬˝Á∑˝§ÿÊ •Áœ∑§Ã◊ Á∑§‚ ŒÊÒ⁄UÊŸ „Ê ÃË „Ò? 114. The process of growth is maximum during :
1¬˝‚ÈÁåà (1) Dormancy
2Log phase (2) ‹ÊÚª ¬˝ÊflSÕÊ
3Lag phase (3) ¬‡øÃÊ ¬˝ÊflSÕÊ
4Senescence (4) ¡ËáʸÃÊ
NTA Answer: Option 2(final)
NEET 2020
⁄UÊÁòÊ ◊ ÿÊ ¬Íáʸ ¬˝Ê×∑§Ê‹ ◊ ÉÊÊ‚ ∑§Ë ¬ÁûÊÿÊ ∑ § ‡ÊË ¸ ‚ ¡‹ ∑ § 134. The process responsible for facilitating loss of water Œ˝fl •flSÕÊ ◊ ÁŸ∑§‹Ÿ ∑§Ê ‚Ȫ◊ ’ŸÊŸ ◊ ∑§ÊÒŸ ‚Ë ¬˝Á∑˝§ÿÊ in liquid form from the tip of grass blades at night ©ûÊ⁄UŒÊÿË „Ê ÃË „Ò? and in early morning is :
1¡ËflŒ˝√ÿ∑È §øŸ (1) Plasmolysis
2flÊc¬Êà ‚¡Ÿ¸ (2) Transpiration
3◊Í‹Ëÿ ŒÊ’ (3) Root pressure
4•à —‡ÊÊ áÊ (4) Imbibition
NTA Answer: Option 3(final)
NEET 2020
ÁŸêŸÁ‹Áπà ◊ ‚ ∑§ÊÒŸ ∞∑§ ’Ë¡ ¬˝‚ÈÁåà ÁŸÿ ÁòÊà ∑§⁄UŸ flÊ‹Ê 135. Which of the following is not an inhibitory ÁŸ⁄UÊ œ∑§ ¬ŒÊÕ¸ Ÿ„Ë „Ò? substance governing seed dormancy ?
1¬Ò⁄UÊ-∞ S∑§ÊÚÁ’¸∑§ •ê‹ (1) Para-ascorbic acid
2Á¡’⁄ UÁ‹∑§ •ê‹ (2) Gibberellic acid
3∞é‚ËÁ‚∑§ •ê‹ (3) Abscisic acid
4Á»§ŸÊ Á‹∑§ •ê‹ (4) Phenolic acid Hindi+English 31 H3
NTA Answer: Option 2(final)