51 questions from NEET 2020, 2021, 2022, 2023, 2024, 2025. Answers verified against NTA official keys.
NEET 2025
Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation?
1Phenotypic ratio - 9 : 7
2Phenotypic ratio - 1 : 2 : 1
3Phenotypic ratio - 3 : 1
4Phenotypic ratio - 9 : 3 : 3 : 1
NTA Answer: Option 4(final)
NEET 2025
Identify the statement that is NOT correct.
1Constant region of heavy and light chains are located at C-terminus of antibody molecules
2Each antibody has two light and two heavy chains.
3The heavy and light chains are held together by disulfide bonds.
4Antigen binding site is located at C-terminal region of antibody molecules.
NTA Answer: Option 4(final)
NEET 2025
With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F generation. 3
NTA Answer: Option 2(final)
NEET 2025
Sweet potato and potato represent a certain type of evolution. Select the correct combination of terms to explain the evolution.
1Analogy, divergent
2Analogy, convergent
3Homology, divergent
4Homology, convergent
NTA Answer: Option 2(final)
NEET 2025
Which factor is important for termination of transcription?
1(gamma)
2(alpha)
3(sigma)
4(rho)
NTA Answer: Option 4(final)
NEET 2025
Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true?
1They have 75% identical genetic content.
2They are monozygotic twins.
3They are fraternal twins.
4They were conceived through in vitro fertilization.
NTA Answer: Option 3(final)
NEET 2025
Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II : DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below :
1Statement I is incorrect but statement II is correct
2Both statement I and statement II are correct
3Both statement I and statement II are incorrect
4Statement I is correct but statement II is incorrect
NTA Answer: Option 2(final)
NEET 2025
What is the pattern of inheritance for polygenic trait?
1X-linked recessive inheritance pattern
2Mendelian inheritance pattern
3Non-mendelian inheritance pattern
4Autosomal dominant pattern
NTA Answer: Option 3(final)
NEET 2024
Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F generation. 2 C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below:
1A, B and C only
2A, C, D and E only
3B, C and D only
4A, B, C, D and E
NTA Answer: Option 2(final)
NEET 2024
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
1Only red flowered plants
2Red flowered as well as pink flowered plants
3Only pink flowered plants
4Red, Pink as well as white flowered plants
NTA Answer: Option 2(final)
NEET 2024
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
1Repressor, Operator gene, Structural gene
2Structural gene, Transposons, Operator gene
3Inducer, Repressor, Structural gene
4Promotor, Structural gene, Terminator
NTA Answer: Option 4(final)
NEET 2024
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will be cross it?
NTA Answer: Option 2(final)
NEET 2024
Which of the following statement is correct regarding the process of replication in E.coli?
1The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
2The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
3The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
4The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
NTA Answer: Option 4(final)
NEET 2024
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below:
1D-A-C-B
2B-A-D-C
3C-B-D-A
4A-D-C-B
NTA Answer: Option 4(final)
NEET 2024
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
1Genetic recombination
2Genetic drift
3Gene migration
4Constant gene pool
NTA Answer: Option 4(final)
NEET 2024
Match List I with List II: List I List II A. RNA polymerase III I. snRNPs B. Termination of II. Promotor transcription C. Splicing of Exons III. Rho factor D. TATA box IV. SnRNAs, tRNA Choose the correct answer from the options given below :
1A-II, B-IV, C-I, D-III
2A-III, B-II, C-IV, D-I
3A-III, B-IV, C-I, D-II
4A-IV, B-III, C-I, D-II
NTA Answer: Option 4(final)
NEET 2024
As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be A. IBi/IAi/ii B. IBIB/IAIA/ii C. IAIB/iIA/IBi D. IAi/IBi/IAi E. iIB/iIA/IAIB Choose the most appropriate answer from the options given below :
1A only
2B only
3C & B only
4D & E only
NTA Answer: Option 1(final)
NEET 2023
The phenomenon of pleiotropism refers to
1Presence of two alleles, each of the two genes controlling a single trait
2A single gene affecting multiple phenotypic expression
3More than two genes affecting a single character
4Presence of several alleles of a single gene controlling a single crossover
NTA Answer: Option 2(final)
NEET 2023
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
1Transcription of tRNA, 5S rRNA and snRNA
2Transcription of precursor of mRNA
3Transcription of only snRNAs
4Transcription of rRNAs (28S, 18S and 5.8S)
NTA Answer: Option 1(final)
NEET 2023
Among eukaryotes, replication of DNA takes place in :
1S phase
2G phase 1
3G phase 2
4M phase
NTA Answer: Option 1(final)
NEET 2023
Expressed Sequence Tags (ESTs) refers to
1All genes that are expressed as proteins.
2All genes whether expressed or unexpressed.
3Certain important expressed genes.
4All genes that are expressed as RNA.
NTA Answer: Option 4(final)
NEET 2023
Unequivocal proof that DNA is the genetic material was first proposed by
1Alfred Hershey and Martha Chase
2Avery, Macleoid and McCarthy
3Wilkins and Franklin
4Frederick Griffith
NTA Answer: Option 1(final)
NEET 2023
Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine developement is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below:
1C and D only
2B and E only
3A and E only
4A and B only
NTA Answer: Option 2(final)
NEET 2023
Broad palm with single palm crease is visible in a person suffering from-
1Turner’s syndrome
2Klinefelter’s syndrome
3Thalassemia
4Down’s syndrome
NTA Answer: Option 4(final)
NEET 2023
Match List I with List II. List I List II A. Gene ‘a’ I. -galactosidase B. Gene ‘y’ II. Transacetylase C. Gene ‘i’ III. Permease D. Gene ‘z’ IV. Repressor protein Choose the correct answer from the options given below:
1A-II, B-III, C-IV, D-I
2A-III, B-IV, C-I, D-II
3A-III, B-I, C-IV, D-II
4A-II, B-I, C-IV, D-III
NTA Answer: Option 1(final)
NEET 2023
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
1Numbat, Spotted cuscus, Flying phalanger
2Mole, Flying squirrel, Tasmanian tiger cat
3Lemur, Anteater, Wolf
4Tasmanian wolf, Bobcat, Marsupial mole
NTA Answer: Option 1(final)
NEET 2023
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
13’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
25’ ATCGATCGATCGATCGATCGATCGATCG 3’
33’ ATCGATCGATCGATCGATCGATCGATCG 5’
45’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
NTA Answer: Option 2(final)
NEET 2022
XO type of sex determination can be found in :
1Monkeys
2Drosophila
3Birds
4Grasshoppers
NTA Answer: Option 4(final)
NEET 2022
The process of translation of mRNA to proteins begins as soon as :
1The tRNA is activated and the larger subunit of ribosome encounters mRNA
2The small subunit of ribosome encounters mRNA
3The larger subunit of ribosome encounters mRNA
4Both the subunits join together to bind with mRNA
NTA Answer: Option 2(final)
NEET 2022
Given below are two statements : Statement I : Mendel studied seven pairs of contrasting traits in pea plants and proposed the Laws of Inheritance. Statement II : Seven characters examined by Mendel in his experiment on pea plants were seed shape and colour, flower colour, pod shape and colour, flower position and stem height. In the light of the above statements, choose the correct answer from the options given below :
1Statement I is incorrect but Statement II is correct
2Both Statement I and Statement II are correct
3Both Statement I and Statement II are incorrect
4Statement I is correct but Statement II is incorrect
NTA Answer: Option 2(final)
NEET 2022
Which of the following occurs due to the presence of autosome linked dominant trait ?
1Thalessemia
2Sickle cell anaemia
3Myotonic dystrophy
4Haemophilia
NTA Answer: Option 3(final)
NEET 2022
If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :
1Bioinformatics
2Sequence annotation
3Gene mapping
4Expressed sequence tags
NTA Answer: Option 2(final)
NEET 2022
Detritivores breakdown detritus into smaller particles. This process is called:
1Decomposition
2Catabolism
3Fragmentation
4Humification
NTA Answer: Option 3(final)
NEET 2022
Natural selection where more individuals acquire specific character value other than the mean character value, leads to
1Random change
2Stabilising change
3Directional change
4Disruptive change
NTA Answer: Option 3(final)
NEET 2022
Under normal physiological conditions in human being every 100 ml of oxygenated blood can deliver ________ ml of O2 to the tissues.
NTA Answer: Option 3(final)
NEET 2022
If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?
16.6 × 106 bp
23.3 × 109 bp
36.6 × 109 bp
43.3 × 106 bp
NTA Answer: Option 2(final)
NEET 2022
Statements related to human Insulin are given below. Which statement(s) is/are correct about genetically engineered Insulin? (a) Pro-hormone insulin contain extra stretch of C-peptide (b) A-peptide and B-peptide chains of insulin were produced separately in E.coli, extracted and combined by creating disulphide bond between them. (c) Insulin used for treating Diabetes was extracted from Cattles and Pigs. (d) Pro-hormone Insulin needs to be processed for converting into a mature and functional hormone. (e) Some patients develop allergic reactions to the foreign insulin. Choose the most appropria
1(c), (d) and (e) only
2(a), (b) and (d) only
3(b) only
4(c) and (d) only
NTA Answer: Option 3(final)
NEET 2022
If a colour blind female marries a man whose mother was also colour blind, what are the chances of her progeny having colour blindness?
NTA Answer: Option 1(final)
NEET 2022
Which of the following is not a desirable feature of a cloning vector?
1Presence of two or more recognition sites
2Presence of origin of replication
3Presence of a marker gene
4Presence of single restriction enzyme site
NTA Answer: Option 1(final)
NEET 2021
The production of gametes by the parents, formation 105. DNA strands on a gel stained with ethidium bromide of zygotes, the F and F plants, can be understood when viewed under UV radiation, appear as 1 2 from a diagram called :
1Bright blue bands (1) Net square
2Yellow bands (2) Bullet square
3Bright orange bands (3) Punch square
4Dark red bands (4) Punnett square
NTA Answer: Option 3(final)
NEET 2021
Match List-I with List-II. (2) (a)-Replication; (b)-Transcription; (c)-Transduction; (d)-Protein (3) (a)-Translation; (b)-Replication; (c)-Transcription;(d)-Transduction (4) (a)-Replication; (b)-Transcription; (c)-Translation; (d)-Protein Answer (4) Choose the correct answer from the options given 127. Which of the following are not secondary below. metabolites in plants? (a) (b) (c) (d)
1Rubber, gums (1) (ii) (i) (iv) (iii)
2Morphine, codeine (2) (ii) (iv) (i) (iii)
3Amino acids, glucose (3) (iv) (iii) (ii) (i)
4(iii) (i) (iv) (ii) (4) Vinblastin, curcumin
NTA Answer: Option 2(final)
NEET 2021
Mutations in plant cells can be induced by: 130. Match List-I with List-II.
1Zeatin
2Kinetin
3Infrared rays
4Gamma rays
NTA Answer: Option 4(final)
NEET 2021
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as (c) Thiobacillus (iii) Conversion of nitrite to nitrate
1Polymorphic DNA (d) Nitrobacter (iv) Conversion of atmospheric nitrogen to ammonia
2Satellite DNA
3Repetitive DNA Choose the correct answer from options given
4Single nucleotides below.
NTA Answer: Option 3(final)
NEET 2021
If Adenine makes 30% of the DNA molecule, what 180. Dobson units are used to measure thickness of: will be the percentage of Thymine, Guanine and
1Troposphere
2CFCs Cytosine in it?
3Stratosphere
4Ozone (1) T : 20 ; G : 25 ; C : 25
NTA Answer: Option 4(final)
NEET 2021
Which of the following RNAs is not required for the synthesis of protein?
1siRNA
2mRNA Choose the correct answer from the options given
3tRNA
4rRNA below.
NTA Answer: Option 1(final)
NEET 2021
In a cross between a male and female, both (1)(iv) (i) (ii) (iii) heterozygous for sickle cell anaemia gene, what (2)(iv) (iii) (i) (ii) percentage of the progeny will be diseased? (3)(iii) (iv) (i) (ii)
1100%
250%
375%
425% (4)(iii) (iv) (ii) (i)
NTA Answer: Option 4(final)
NEET 2020
Which of the following refer to correct example(s) of organisms which have evolved due to changes 97. ÁŸêŸ ◊ ∑§ÊÒŸ, ∞ ‚ ¡ËflÊ ∑ § ‚„Ë ©ŒÊ„⁄UáÊÊ ∑§Ê ‚ ŒÁ÷¸Ã ∑§⁄UÃÊ „Ò in environment brought about by anthropogenic ¡Ê ◊ÊŸfl ∑§Ë Á∑˝§ÿÊ•Ê mÊ⁄UÊ flÊÃÊfl⁄UáÊ ◊ ’Œ‹Êfl ∑ § ∑§Ê⁄UáÊ action ? Áfl∑§Á‚à „È∞ „Ò? (a) Darwin’s Finches of Galapagos islands. (a) ªÒ‹Ê¬ÒªÊ mˬ ◊ «UÊÁfl¸Ÿ ∑§Ë Á» §ø (b) Herbicide resistant weeds. (b) π⁄U¬ÃflÊ⁄UÊ ◊ ‡ÊÊ∑§ŸÊ‡ÊË ∑§Ê ¬˝ÁÃ⁄UÊ œ (c) Drug resistant eukaryotes. (c) ‚‚Ë◊∑ §ãŒ˝∑§Ê ◊ ŒflÊßÿÊ ∑§Ê ¬˝ÁÃ⁄UÊ œ (d) Man-created breeds of domesticated animal
1∑ §fl‹ (d) (1) only (d)
2∑ §fl‹ (a) (2) only (a)
3(a) ∞fl (c) (3) (a) and (c)
4(b), (c) ∞fl (d) (4) (b), (c) and (d) Hindi+English 23 H3
NTA Answer: Option 4(final)
NEET 2020
•ŸÈ‹ πŸ ∑ § ‚◊ÿ «UË.∞Ÿ.∞. ∑§Ë ∑È §«U‹Ë ∑§Ê πÊ ‹Ÿ ◊ ∑§ÊÒŸ‚Ê
1RNA polymerase ∞ ¡Êß◊ ◊ŒŒ ∑§⁄UÃÊ „Ò?
2DNA ligase (1) •Ê⁄U.∞Ÿ.∞. ¬ÊÚÁ‹◊⁄ U$¡
3DNA helicase
4DNA polymerase (2) «UË.∞Ÿ.∞. ‹Êߪ $¡ (3) «UË.∞Ÿ.∞. „Ò‹Ë∑ §$¡ 117. Snow-blindness in Antarctic region is due to : (4) «UË.∞Ÿ.∞. ¬ÊÚ‹Ë◊⁄ U$¡ (1) Damage to retina caused by infra-red rays (2) Freezing of fluids in the eye by low
NTA Answer: Option 1(final)
NEET 2020
¡ËŸ ‘I’ ¡Ê ABO ⁄UÄà flª¸ ∑§Ê ÁŸÿ òÊáÊ ∑§⁄UÃÊ „Ò ©‚∑ § ‚ Œ÷¸ 121. Identify the wrong statement with reference to the gene ‘I’ that controls ABO blood groups. ◊ ª‹Ã ∑§ÕŸ ∑§Ê ¬„øÊÁŸ∞–
1Allele ‘i’ does not produce any sugar. (1) ‘i’ ∞ ‹Ë‹ ∑§Ê ߸ ÷Ë ‡Ê∑¸§⁄UÊ ©à¬ÛÊ Ÿ„Ë ∑§⁄UÃÊ–
2The gene (I) has three alleles. (2) ¡ËŸ (I) ∑ § ÃËŸ ∞ ‹Ë‹ „Ê Ã „Ò –
3A person will have only two of the three (3) ∞∑§ √ÿÁÄà ◊ ÃËŸ ◊ ‚ ∑ §fl‹ ŒÊ ∞ ‹Ë‹ „Ê ª – alleles.
4¡’ IA ∞fl IB ŒÊ ŸÊ ß∑§_ „Ê Ã „Ò , ÿ ∞∑§ ¬˝∑§Ê⁄U ∑§Ë (4) When IA and IB are present together, they ‡Ê∑¸§⁄UÊ •Á÷√ÿÄà ∑§⁄Uà „Ò – express same type of sugar.
NTA Answer: Option 4(final)
NEET 2020
≈˛UÊ ‚‹ ‡ÊŸ (•ŸÈflÊŒŸ/SÕÊŸÊ Ã⁄UáÊ) ∑§Ë ¬˝Õ◊ •flSÕÊ ∑§ÊÒŸ ‚Ë 123. The first phase of translation is : „Ê ÃË „Ò?
1Recognition of an anti-codon (1) ∞∑§ ∞ ≈UË-∑§Ê «UÊÚŸ ∑§Ë ¬„øÊŸ
2Binding of mRNA to ribosome (2) ⁄UÊß’Ê ‚Ê ◊ ‚ mRNA ∑§Ê ’㜟
3Recognition of DNA molecule (3) «UË.∞Ÿ.∞. •áÊÈ ∑§Ë ¬„øÊŸ
4Aminoacylation of tRNA (4) tRNA ∑§Ê ∞ ◊ËŸÊ ∞‚Ë‹ ‡ÊŸ
NTA Answer: Option 4(final)
NEET 2020
◊ «U‹ Ÿ Sflà òÊ M§¬ ‚ ¬˝¡ŸŸ ∑§⁄UŸ flÊ‹Ë ◊≈U⁄U ∑ § ¬ÊÒœ ∑§Ë 130. How many true breeding pea plant varieties did Mendel select as pairs, which were similar except Á∑§ÃŸË Á∑§S◊Ê ∑§Ê ÿÈÇ◊Ê ∑ § M§¬ ◊ øÈŸÊ ¡Ê Áfl¬⁄UËà Áfl‡Ê ∑§Ê in one character with contrasting traits ? flÊ‹ ∞∑§ ‹ˇÊáÊ ∑ § •‹ÊflÊ ∞∑§ ‚◊ÊŸ ÕË?
18 (1) 8
24 (2) 4
32 (3) 2
414 (4) 14 H3 30 Hindi+English
NTA Answer: Option 4(final)