Genetics and Evolution

Easy Recall (5)Direct Application (1)Concept Trap (2)

DNA RNA Structure

8 MCQs1 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (2)

Evidences Evolution

8 MCQs8 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (2)

Gene Regulation Lac Operon

Easy Recall (3)Direct Application (3)Concept Trap (2)

Genetic Code

8 MCQs1 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (2)

Genetic Material DNA Packaging

8 MCQs9 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (2)

Hardy Weinberg Principle

8 MCQs2 PYQs5 revision cardsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

Hominid Evolution

8 MCQs2 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

Human Genome Project

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

Incomplete Dominance Codominance

8 MCQs6 PYQs2 revision cardsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (2)

Linkage Recombination Mapping

8 MCQs3 PYQs1 revision cardWorked example

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

Mendel Inheritance

8 MCQs8 PYQs4 revision cardsWorked example

Easy Recall (3)Direct Application (3)Calculation (1)Concept Trap (1)

Mendelian Disorders Pedigree

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

Mutations Genetic Disorders

8 MCQs5 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (2)

Natural Selection Drift

Easy Recall (3)Direct Application (3)Concept Trap (2)

Origin Life Panspermia

8 MCQsWorked example

Easy Recall (3)Concept Trap (2)Direct Application (3)

Sex Determination Linkage

8 MCQs2 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

Transcription Translation

8 MCQs15 PYQsWorked example

Easy Recall (3)Direct Application (3)Concept Trap (1)Calculation (1)

NCERT lines NEET tested in this unit

Each line with its printed NCERT page and the past NEET questions that tested it.

Past-paper questions from this unit

82 questions from NEET 2020, 2021, 2022, 2023, 2024, 2025, 2026. Answers verified against NTA official keys.

By year in our set: 2020 (6) · 2021 (11) · 2022 (14) · 2023 (12) · 2024 (15) · 2025 (13) · 2026 (11)

Given below are two statements : Statement I : Down's syndrome is caused by the absence of one of the X-chromosomes. Statement II : Turner's syndrome is caused by the presence of an additional copy of the chromosomes. In the light of the above statements, choose the correct answer from the options given below :

NEET 2026

1Both Statement I and Statement II are correct

2Both Statement I and Statement II are incorrect

3Statement I is correct but Statement II is incorrect

4Statement I is incorrect but Statement II is correct

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Natural selection can lead to ______. (a) stabilisation (b) genetic drift (c) directional change (d) disruption. Choose the correct answer from the options given below :

NEET 2026

1(a) only

2(a), (c) and (d) only

3(a), (b), (c) and (d)

4(a) and (c) only

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

A population of diploid organisms is at Hardy-Weinberg equilibrium. If the frequency of allele A is 0.1, the frequency of AA is ______.

NEET 2026

10.01

20.02

30.10

40.99

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Which of the following statements about lac-operon is correct ?

NEET 2026

1Gene i is constitutively expressed

2Lactose activates repressor to bind to the operator

3Genes i, z, y and a share single common promoter

4Galactose can act as an inducer of lac operon

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Which of the following is not evidence for evolution ?

NEET 2026

1Convergent evolution of traits like wings of birds and butterflies

2Paleontological evidence from fossil records

3Embryological support for evolution as proposed by Ernst Heckel

4Divergent evolution of anatomical structures such as forelimbs

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Lesson: Hominid Evolution

NEET 2026

Given below are two statements : Statement I : Modern Homo sapiens arose in Australia and moved across continents. Statement II : Homo sapiens arose around 75000 to 10000 years ago. In the light of the above statements, choose the most appropriate answer from the options given below :

1Both Statement I and Statement II are correct

2Both Statement I and Statement II are incorrect

3Statement I is correct but Statement II is incorrect

4Statement I is incorrect but Statement II is correct

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Adaptive radiation in placental mammals and Australian Marsupials leading to similarity between distant species is an example of ______.

NEET 2026

1divergent evolution

2convergent evolution

3founder effect

4genetic drift

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Which of the following enzymes synthesizes precursor mRNA ?

NEET 2026

1RNA polymerase I

2RNA polymerase II

3RNA polymerase III

4DNA polymerase

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

For a person with blood group 'O', which of the following is not a possible combination of parents' blood group genotypes ?

NEET 2026

1Father : I^A i and Mother : I^B i

2Father : I^A i and Mother : I^A i

3Father : I^B i and Mother : I^B i

4Father : I^A I^B and Mother : I^A i

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : Forelimbs of human and bats are homologous. Reason R : Forelimbs of humans and bats have similar anatomical structure. In the light of the above statements, choose the most appropriate answer from the options given below :

NEET 2026

1Both A and R are correct and R is the correct explanation of A

2Both A and R are true, but R is not the correct explanation of A

3A is true but R is false

4A is false but R is true

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2026

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : In an experiment, Mendel observed that the F1 progeny plants are all tall and none are dwarf. Reason R : Stem height is a contrasting trait, with tall being dominant and dwarf being recessive. In the light of the above statements, choose the most appropriate answer from the options given below :

1Both A and R are correct and R is the correct explanation of A

2Both A and R are correct but R is not the correct explanation of A

3A is correct but R is not correct

4A is not correct but R is correct

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2025

Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation?

1Phenotypic ratio - 9 : 7

2Phenotypic ratio - 1 : 2 : 1

3Phenotypic ratio - 3 : 1

4Phenotypic ratio - 9 : 3 : 3 : 1

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F3 generation.

NEET 2025

1Zero

21/4

31/2

41/8

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Lesson: Genetic Code

NEET 2025

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

1Franklin Stahl

2George Gamow

3Francis Crick

4Jacque Monod

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Sweet potato and potato represent a certain type of evolution. Select the correct combination of terms to explain the evolution.

NEET 2025

1Analogy, divergent

2Analogy, convergent

3Homology, divergent

4Homology, convergent

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Histones are enriched with -

NEET 2025

1Phenylalanine & Arginine

2Lysine & Arginine

3Leucine & Lysine

4Phenylalanine & Leucine

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Which factor is important for termination of transcription?

NEET 2025

1(gamma)

2(alpha)

3(sigma)

4(rho)

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Lesson: Sex Determination Linkage

NEET 2025

Twins are born to a family that lives next door to you. The twins are a boy and a girl. Which of the following must be true?

1They have 75% identical genetic content.

2They are monozygotic twins.

3They are fraternal twins.

4They were conceived through in vitro fertilization.

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out essential life processes. RNA acts as a genetic material and also as a catalyst for some important biochemical reactions in living systems. Being reactive, RNA is unstable. Statement II : DNA evolved from RNA and is a more stable genetic material. Its double helical strands being complementary, resist changes by evolving repairing mechanism. In the light of the above statements, choose the most appropriate answer from the options given below :

NEET 2025

1Statement I is incorrect but statement II is correct

2Both statement I and statement II are correct

3Both statement I and statement II are incorrect

4Statement I is correct but statement II is incorrect

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Given below are two statements : Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II : RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence. In the light of the above statements, choose the most appropriate answer from the options given below :

NEET 2025

1Statement I is incorrect but statement II is correct

2Both statement I and statement II are correct

3Both statement I and statement II are incorrect

4Statement I is correct but statement II is incorrect

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

What is the pattern of inheritance for polygenic trait?

NEET 2025

1X-linked recessive inheritance pattern

2Mendelian inheritance pattern

3Non-mendelian inheritance pattern

4Autosomal dominant pattern

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing. B. Removal of introns and joining of exons. C. Addition of methyl group at 5’ end of hnRNA. D. Addition of adenine residues at 3' end of hnRNA. E. Base pairing of two complementary RNAs. Choose the correct answer from the options given below :

NEET 2025

1C, D, E only

2A, B, C only

3B, C, D only

4B, C, E only

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Match List I with List II: List-I List-II A. Alfred Hershey and Martha Chase I. Streptococcus pneumoniae B. Euchromatin II. Densely packed and dark-stained C. Frederick Griffith III. Loosely packed and light-stained D. Heterochromatin IV. DNA as genetic material confirmation Choose the correct answer from the options given below:

NEET 2025

1A-III, B-II, C-IV, D-I

2A-II, B-IV, C-I, D-III

3A-IV, B-II, C-I, D-III

4A-IV, B-III, C-I, D-II

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Which chromosome in the human genome has the highest number of genes?

NEET 2025

1Chromosome 10

2Chromosome X

3Chromosome Y

4Chromosome 1

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

The lactose present in the growth medium of bacteria is transported to the cell by the action of

NEET 2024Revised key

1Beta-galactosidase

2Acetylase

3Permease

4Polymerase

NTA Answer: Option 3(revised_final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2024Revised key

Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and the other is recessive. B. Alleles do not show any expression and both the characters appear as such in F generation. 2 C. Factors occur in pairs in normal diploid plants. D. The discrete unit controlling a particular character is called factor. E. The expression of only one of the parental characters is found in a monohybrid cross. Choose the correct answer from the options given below:

1A, B and C only

2A, C, D and E only

3B, C and D only

4A, B, C, D and E

NTA Answer: Option 2(revised_final)

Report an error · Every fix is public: corrections log

A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?

NEET 2024Revised key

1Only red flowered plants

2Red flowered as well as pink flowered plants

3Only pink flowered plants

4Red, Pink as well as white flowered plants

NTA Answer: Option 2(revised_final)

Report an error · Every fix is public: corrections log

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

NEET 2024Revised key

1Repressor, Operator gene, Structural gene

2Structural gene, Transposons, Operator gene

3Inducer, Repressor, Structural gene

4Promotor, Structural gene, Terminator

NTA Answer: Option 4(revised_final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2024Revised key

In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant, with which of the following genotype will be cross it?

1BB

2bb

3Bb

4BB/Bb

NTA Answer: Option 2(revised_final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2024Revised key

Match List I with List II List I List II A. Two or more alternative forms of a gene I. Back cross B. Cross of F progeny with homozygous II. Ploidy 1 recessive parent C. Cross of F progeny with any of the parents III. Allele 1 D. Number of chromosome sets in plant IV. Test cross Choose the correct answer from the options given below:

1A-I, B-II, C-III, D-IV

2A-II, B-I, C-III, D-IV

3A-III, B-IV, C-I, D-II

4A-IV, B-III, C-II, D-I

NTA Answer: Option 3(revised_final)

Report an error · Every fix is public: corrections log

Lesson: DNA Replication

NEET 2024Revised key

Which of the following statement is correct regarding the process of replication in E.coli?

1The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’

2The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’

3The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction

4The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction

NTA Answer: Option 4(revised_final)

Report an error · Every fix is public: corrections log

Match List I with List II List I List II A. Frederick Griffith I. Genetic code B. Francois Jacob & Jacque II. Semi-conservative mode of DNA replication C. Har Gobind Khorana III. Transformation D. Meselson & Stahl IV. Lac operon Choose the correct answer from the options given below:

NEET 2024Revised key

1A-III, B-II, C-I, D-IV

2A-III, B-IV, C-I, D-II

3A-II, B-III, C-IV, D-I

4A-IV, B-I, C-II, D-III

NTA Answer: Option 2(revised_final)

Report an error · Every fix is public: corrections log

The flippers of the Penguins and Dolphins are the example of the

NEET 2024Revised key

1Adaptive radiation

2Natural selection

3Convergent evolution

4Divergent evolution

NTA Answer: Option 3(revised_final)

Report an error · Every fix is public: corrections log

Lesson: Hominid Evolution

NEET 2024Revised key

Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below:

1D-A-C-B

2B-A-D-C

3C-B-D-A

4A-D-C-B

NTA Answer: Option 4(revised_final)

Report an error · Every fix is public: corrections log

Which one of the following factors will not affect the Hardy-Weinberg equilibrium?

NEET 2024Revised key

1Genetic recombination

2Genetic drift

3Gene migration

4Constant gene pool

NTA Answer: Option 4(revised_final)

Report an error · Every fix is public: corrections log

Match List I with List II List I List II A. Down’s syndrome I. 11th chormosome B. -Thalassemia II. ‘X’ chromosome C. -Thalassemia III. 21st chromosome D. Klinefelter’s syndrome IV. 16th chromosome Choose the correct answer from the options given below :

NEET 2024Revised key

1A-I, B-II, C-III, D-IV

2A-II, B-III, C-IV, D-I

3A-III, B-IV, C-I, D-II

4A-IV, B-I, C-II, D-III

NTA Answer: Option 3(revised_final)

Report an error · Every fix is public: corrections log

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3’TACATGGCAAATATCCATTCA5’

NEET 2024Revised key

15’AUGUACCGUUUAUAGGUAAGU3’

25’AUGUAAAGUUUAUAGGUAAGU3’

35’AUGUACCGUUUAUAGGGAAGU3’

45’ATGTACCGTTTATAGGTAAGT3’

NTA Answer: Option 1(revised_final)

Report an error · Every fix is public: corrections log

Match List I with List II: List I List II A. RNA polymerase III I. snRNPs B. Termination of II. Promotor transcription C. Splicing of Exons III. Rho factor D. TATA box IV. SnRNAs, tRNA Choose the correct answer from the options given below :

NEET 2024Revised key

1A-II, B-IV, C-I, D-III

2A-III, B-II, C-IV, D-I

3A-III, B-IV, C-I, D-II

4A-IV, B-III, C-I, D-II

NTA Answer: Option 4(revised_final)

Report an error · Every fix is public: corrections log

As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be A. IBi/IAi/ii B. IBIB/IAIA/ii C. IAIB/iIA/IBi D. IAi/IBi/IAi E. iIB/iIA/IAIB Choose the most appropriate answer from the options given below :

NEET 2024Revised key

1A only

2B only

3C & B only

4D & E only

NTA Answer: Option 1(revised_final)

Report an error · Every fix is public: corrections log

The phenomenon of pleiotropism refers to

NEET 2023

1Presence of two alleles, each of the two genes controlling a single trait

2A single gene affecting multiple phenotypic expression

3More than two genes affecting a single character

4Presence of several alleles of a single gene controlling a single crossover

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

NEET 2023

1Transcription of tRNA, 5S rRNA and snRNA

2Transcription of precursor of mRNA

3Transcription of only snRNAs

4Transcription of rRNAs (28S, 18S and 5.8S)

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Lesson: DNA Replication

NEET 2023

Among eukaryotes, replication of DNA takes place in :

1S phase

2G phase 1

3G phase 2

4M phase

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Expressed Sequence Tags (ESTs) refers to

NEET 2023

1All genes that are expressed as proteins.

2All genes whether expressed or unexpressed.

3Certain important expressed genes.

4All genes that are expressed as RNA.

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by

NEET 2023

1Sutton and Boveri

2Alfred Sturtevant

3Henking

4Thomas Hunt Morgan

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Unequivocal proof that DNA is the genetic material was first proposed by

NEET 2023

1Alfred Hershey and Martha Chase

2Avery, Macleoid and McCarthy

3Wilkins and Franklin

4Frederick Griffith

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Which of the following statements are correct about Klinefelter’s Syndrome? A. This disorder was first described by Langdon Down (1866). B. Such an individual has overall masculine development. However, the feminine developement is also expressed. C. The affected individual is short statured. D. Physical, psychomotor and mental development is retarded. E. Such individuals are sterile. Choose the correct answer from the options given below:

NEET 2023

1C and D only

2B and E only

3A and E only

4A and B only

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. In the light of the above statements, choose the correct answer from the options given below:

NEET 2023

1Both Statement I and Statement II are false.

2Statement I is correct but Statement II is false.

3Statement I is incorrect but Statement II is true.

4Both Statement I and Statement II are true.

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Broad palm with single palm crease is visible in a person suffering from-

NEET 2023

1Turner’s syndrome

2Klinefelter’s syndrome

3Thalassemia

4Down’s syndrome

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Match List I with List II. List I List II A. Gene ‘a’ I. -galactosidase B. Gene ‘y’ II. Transacetylase C. Gene ‘i’ III. Permease D. Gene ‘z’ IV. Repressor protein Choose the correct answer from the options given below:

NEET 2023

1A-II, B-III, C-IV, D-I

2A-III, B-IV, C-I, D-II

3A-III, B-I, C-IV, D-II

4A-II, B-I, C-IV, D-III

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

NEET 2023

1Numbat, Spotted cuscus, Flying phalanger

2Mole, Flying squirrel, Tasmanian tiger cat

3Lemur, Anteater, Wolf

4Tasmanian wolf, Bobcat, Marsupial mole

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

NEET 2023

13’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’

25’ ATCGATCGATCGATCGATCGATCGATCG 3’

33’ ATCGATCGATCGATCGATCGATCGATCG 5’

45’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Read the following statements and choose the set of correct statements : (a) Euchromatin is loosely packed chromatin (b) Heterochromatin is transcriptionally active (c) Histone octomer is wrapped by negatively charged DNA in nucleosome (d) Histones are rich in lysine and arginine (e) A typical nucleosome contains 400 bp of DNA helix Choose the correct answer from the options given below :

NEET 2022

1(a), (c), (e) Only

2(b), (d), (e) Only

3(a), (c), (d) Only

4(b), (e) Only

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Lesson: Sex Determination Linkage

NEET 2022

XO type of sex determination can be found in :

1Monkeys

2Drosophila

3Birds

4Grasshoppers

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

The process of translation of mRNA to proteins begins as soon as :

NEET 2022

1The tRNA is activated and the larger subunit of ribosome encounters mRNA

2The small subunit of ribosome encounters mRNA

3The larger subunit of ribosome encounters mRNA

4Both the subunits join together to bind with mRNA

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2022

Given below are two statements : Statement I : Mendel studied seven pairs of contrasting traits in pea plants and proposed the Laws of Inheritance. Statement II : Seven characters examined by Mendel in his experiment on pea plants were seed shape and colour, flower colour, pod shape and colour, flower position and stem height. In the light of the above statements, choose the correct answer from the options given below :

1Statement I is incorrect but Statement II is correct

2Both Statement I and Statement II are correct

3Both Statement I and Statement II are incorrect

4Statement I is correct but Statement II is incorrect

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Which of the following occurs due to the presence of autosome linked dominant trait ?

NEET 2022

1Thalessemia

2Sickle cell anaemia

3Myotonic dystrophy

4Haemophilia

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different segments, the methodology adopted by him is called as :

NEET 2022

1Bioinformatics

2Sequence annotation

3Gene mapping

4Expressed sequence tags

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : Mendel’s law of Independent assortment does not hold good for the genes that are located closely on the same chromosome. Reason (R) : Closely located genes assort independently. In the light of the above statements, choose the correct answer from the options given below:

NEET 2022

1(A) is not correct but (R) is correct

2Both (A) and (R) are correct and (R) is the correct explanation of (A)

3Both (A) and (R) are correct but (R) is not the correct explanation of (A)

4(A) is correct but (R) is not correct

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what will be the outcome?

NEET 2022

1RNA polymerase will bind the promoter region

2Only z gene will get transcribed

3z, y, a genes will be transcribed

4z, y, a genes will not be translated

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Natural selection where more individuals acquire specific character value other than the mean character value, leads to

NEET 2022

1Random change

2Stabilising change

3Directional change

4Disruptive change

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?

NEET 2022

16.6 × 10⁶ bp

23.3 × 10⁹ bp

36.6 × 10⁹ bp

43.3 × 10⁶ bp

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

The recombination frequency between the genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is 20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear chromosome?

NEET 2022

1a, c, b, d

2a, d, b, c

3d, b, a, c

4a, b, c, d

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

If a colour blind female marries a man whose mother was also colour blind, what are the chances of her progeny having colour blindness?

NEET 2022

1100%

225%

350%

475%

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Lesson: DNA Replication

NEET 2022

Ten E.coli cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60 minutes, how many E.coli cells will have DNA totally free from 15N?

180 cells

220 cells

340 cells

460 cells

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Which of the following statements is not true?

NEET 2022

1Flippers of penguins and dolphins are a pair of homologous organs

2Analogous structures are a result of convergent evolution

3Sweet potato and potato is an example of analogy

4Homology indicates common ancestry

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2021

The production of gametes by the parents, formation of zygotes, the F1 and F2 plants, can be understood from a diagram called :

1Net square

2Bullet square

3Punch square

4Punnett square

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

The factor that leads to Founder effect in a population is :

NEET 2021

1Genetic drift

2Natural selection

3Genetic recombination

4Mutation

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Lesson: DNA Replication

NEET 2021

Match List-I with List-II. Choose the correct answer from the options given below. (a) (b) (c) (d)

1(ii) (i) (iv) (iii)

2(ii) (iv) (i) (iii)

3(iv) (iii) (ii) (i)

4(iii) (i) (iv) (ii)

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Mutations in plant cells can be induced by:

NEET 2021

1Zeatin

2Kinetin

3Infrared rays

4Gamma rays

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

What is the role of RNA polymerase III in the process of transcription in eukaryotes?

NEET 2021

1Transcribes only snRNAs

2Transcribes rRNAs (28S, 18S and 5.8S)

3Transcribes tRNA, 5s rRNA and snRNA

4Transcribes precursor of mRNA

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as

NEET 2021

1Polymorphic DNA

2Satellite DNA

3Repetitive DNA

4Single nucleotides

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Identify the correct statement.

NEET 2021

1Split gene arrangement is characteristic of prokaryotes

2In capping, methyl guanosine triphosphate is added to the 3' end of hnRNA

3RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria

4The coding strand in a transcription unit is copied to an mRNA

NTA Answer: Option 3(final)

Report an error · Every fix is public: corrections log

Lesson: DNA RNA Structure

NEET 2021

If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?

1T : 20 ; G : 25 ; C : 25

2T : 20 ; G : 30 ; C : 20

3T : 20 ; G : 20 ; C : 30

4T : 30 ; G : 20 ; C : 20

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Which of the following RNAs is not required for the synthesis of protein?

NEET 2021

1siRNA

2mRNA

3tRNA

4rRNA

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

In a cross between a male and female, both heterozygous for sickle cell anaemia gene, what percentage of the progeny will be diseased?

NEET 2021

1100%

250%

375%

425%

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Match List - I with List - II List - I List - II (a) Adaptive radiation (b) Convergent evolution (c) Divergent evolution (d) Evolution by anthropogenic action (i) Selection of resistant varieties due to excessive use of herbicides and pesticides (ii) of Bones forelimbs in Man and Whale (iii) Wings of Butterfly and Bird (iv) Darwin Finches Choose the correct anser from the options given below. (a) (b) (c) (d)

NEET 2021

1(i) (iv) (iii) (ii)

2(iv) (iii) (ii) (i)

3(iii) (ii) (i) (iv)

4(ii) (i) (iv) (iii)

NTA Answer: Option 2(final)

Report an error · Every fix is public: corrections log

Which of the following refer to correct example(s) of organisms which have evolved due to changes in environment brought about by anthropogenic action ? (a) Darwin’s Finches of Galapagos islands. (b) Herbicide resistant weeds. (c) Drug resistant eukaryotes. (d) Man-created breeds of domesticated animals like dogs.

NEET 2020

1only (d)

2only (a)

3(a) and (c)

4(b), (c) and (d)

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 10⁹ bp, then the length of the DNA is approximately :

NEET 2020

12.7 meters

22.0 meters

32.5 meters

42.2 meters

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Name the enzyme that facilitates opening of DNA helix during transcription.

NEET 2020

1RNA polymerase

2DNA ligase

3DNA helicase

4DNA polymerase

NTA Answer: Option 1(final)

Report an error · Every fix is public: corrections log

Identify the wrong statement with reference to the gene ‘I’ that controls ABO blood groups.

NEET 2020

1Allele ‘i’ does not produce any sugar.

2The gene (I) has three alleles.

3A person will have only two of the three alleles.

4When IA and IB are present together, they express same type of sugar.

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

The first phase of translation is :

NEET 2020

1Recognition of an anti-codon

2Binding of mRNA to ribosome

3Recognition of DNA molecule

4Aminoacylation of tRNA

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Lesson: Mendel Inheritance

NEET 2020

How many true breeding pea plant varieties did Mendel select as pairs, which were similar except in one character with contrasting traits ?

414

NTA Answer: Option 4(final)

Report an error · Every fix is public: corrections log

Exam traps and common mistakes in this unit

Lesson: DNA Replication

Trap

5' → 3' synthesis polarity

Category: Sign Convention

DNA polymerase synthesises only 5'→3'. Leading strand: continuous, same direction as fork. Lagging: discontinuous (Okazaki), opposite to fork.

When it triggers

Question on Okazaki, leading vs lagging, primer direction.

How to avoid

Reading template 3'→5'; synthesising 5'→3'. Lagging strand needs short fragments because it can't run continuously against fork direction.

Lesson: Genetic Code

Trap

64 vs 61 vs 3 codon count confusion

Category: Overthinking

Students misstate that all 64 codons code for amino acids, forgetting 3 are stop codons, or forget AUG's dual role.

When it triggers

A question asks how many codons code for amino acids and offers 64 as a distractor instead of 61, or asks what AUG codes for and omits its role as the initiator codon.

How to avoid

Of 64 possible triplet codons, 61 code for amino acids and 3 (UAA, UAG, UGA) are stop/terminator codons that code for no amino acid; AUG both codes for Methionine and acts as the initiator codon.

Lesson: Genetic Code

Trap

Frameshift mutation base-count exception

Category: Inorganic Exception

Students assume any insertion/deletion causes a frameshift, missing that insertions/deletions of three bases (or multiples of three) leave the reading frame unaltered.

When it triggers

A question states 3 bases (or a multiple of 3) were inserted or deleted and asks whether the reading frame shifts, and a distractor claims a frameshift always occurs.

How to avoid

Insertion or deletion of one or two bases shifts the reading frame from that point (frameshift mutation); insertion or deletion of three bases, or a multiple of three, only adds/removes whole codons (amino acids) and the reading frame remains unaltered thereafter, as shown by the 'RAM HAS RED CAP' example.

Trap

Griffith vs Avery-MacLeod-McCarty vs Hershey-Chase mixup

Category: Similar Terms

NEET questions swap which experiment proved DNA is the genetic material versus which only showed a 'transforming principle' existed.

When it triggers

A question describes the heat-killed S + live R mouse experiment and asks who proved DNA is the genetic material, expecting Griffith when it was Avery-MacLeod-McCarty (biochemical proof) or Hershey-Chase (unequivocal proof with bacteriophages).

How to avoid

Griffith (1928) only showed a 'transforming principle' existed without identifying its biochemical nature; Avery-MacLeod-McCarty (1933-44) showed DNA alone causes transformation; Hershey-Chase (1952) gave the unequivocal proof using radiolabeled phosphorus/sulfur in bacteriophages.

Trap

Nucleosome bp count vs histone octamer count confusion

Category: Negative Marking

Students confuse the number of DNA base pairs per nucleosome (200 bp) with the number of histone molecules per octamer (8).

When it triggers

A question asks 'how many base pairs are wrapped in a typical nucleosome' and offers 8 as a distractor, or asks the number of histone molecules and offers 200.

How to avoid

A histone octamer is made of eight histone molecules; a typical nucleosome (DNA wrapped around that octamer) contains 200 bp of DNA helix — these are two distinct numbers from the same sentence.

Trap

Hardy-Weinberg disequilibrium causes

Category: Negative Marking

Five forces disturb HW: mutation, gene flow, drift, selection, non-random mating. ANY of these violates equilibrium.

When it triggers

Question asks which factor maintains/disturbs HW.

How to avoid

Random mating + no other forces → equilibrium. ANY of mutation/migration/drift/selection/assortative mating → disequilibrium.

Lesson: Mendel Inheritance

Trap

Genotype vs phenotype ratio confusion

Category: Similar Terms

Monohybrid: genotype 1:2:1 (AA:Aa:aa); phenotype 3:1.

When it triggers

Question asks for one ratio while presenting cross details.

How to avoid

Always note dominance: phenotype merges Aa + AA; genotype keeps them separate.

Trap

Thalassemia (quantitative) vs sickle-cell anaemia (qualitative) mixup

Category: Similar Terms

Students confuse thalassemia's quantitative globin-synthesis defect with sickle-cell anaemia's qualitative structural defect, or mix up which is X-linked vs autosomal.

When it triggers

A question asks which disorder involves 'too little normal globin produced' vs 'an incorrectly functioning globin protein' and swaps thalassemia and sickle-cell anaemia, or claims either is sex-linked.

How to avoid

Thalassemia is an autosome-linked recessive disease that is a quantitative problem — too few globin molecules synthesised (alpha chain via HBA1/HBA2 on chromosome 16, beta chain via HBB on chromosome 11); sickle-cell anaemia is also autosome-linked recessive but is a qualitative problem — an incorrectly functioning (sickle-shaped) globin from a Glu-to-Val substitution at the sixth position of the beta chain.

Trap

Sympatric vs allopatric speciation

Category: Similar Terms

Allopatric: geographic isolation. Sympatric: same area, no physical barrier (e.g. polyploidy in plants, host-shift).

When it triggers

Question gives speciation scenario and asks which type.

How to avoid

If geographic barrier mentioned → allopatric. If population overlaps → sympatric.

Lesson: Sex Determination Linkage

Trap

X-linked recessive: father→daughter expression

Category: Similar Terms

X-linked recessive (haemophilia, colour-blindness): affects males predominantly; carrier mother → 50% sons affected; affected father → all daughters carriers but not affected.

When it triggers

Pedigree question; carrier vs affected.

How to avoid

Sex chromosomes: XX vs XY. Recessive on X needs both copies (XaXa) in female, only one (XaY) in male.

Lesson: DNA Replication

Mistake

Says lagging strand is synthesised 3'→5' (no DNA polymerase does this).

Root cause: concept gap

Correction

ALL DNA pol synthesises 5'→3'. Lagging strand uses Okazaki fragments to APPEAR to extend toward fork while each fragment grows 5'→3'.

Lesson: Genetic Code

Mistake

Students confuse 'degenerate' (one amino acid coded by multiple codons) with 'ambiguous' (one codon coding for multiple amino acids), which the genetic code is not.

Root cause: term confusion

Correction

The genetic code is degenerate because some amino acids are coded by more than one codon; it is unambiguous because each codon is read in mRNA in a contiguous fashion specifying only one amino acid, with no punctuations between codons.

Wrong option pattern

labels the code as 'ambiguous' or claims one codon can specify multiple amino acids

Lesson: Genetic Code

Mistake

Under time pressure, students mark any insertion/deletion of bases as a frameshift mutation without checking whether the number of bases is a multiple of three.

Root cause: rushed under time pressure

Correction

Only insertion or deletion of one or two bases (not a multiple of three) shifts the reading frame from that point onward; insertion or deletion of three bases or multiples of three only adds or removes whole codons, leaving the downstream reading frame unaltered.

Wrong option pattern

marks a 3-base or 6-base insertion/deletion as causing a frameshift

Mistake

Students attribute the unequivocal proof that DNA is the genetic material to Griffith or to Avery-MacLeod-McCarty instead of Hershey and Chase.

Root cause: term confusion

Correction

Griffith (1928) demonstrated a 'transforming principle' without identifying it biochemically; Avery-MacLeod-McCarty (1933-44) showed DNA alone causes transformation biochemically; Hershey and Chase (1952) gave the unequivocal proof using radiolabeled bacteriophages.

Wrong option pattern

selects Griffith or Avery-MacLeod-McCarty as the 'unequivocal proof' source instead of Hershey-Chase

Mistake

Students believe RNA is more chemically stable than DNA because RNA is more 'active' in cells, reversing the actual stability comparison.

Root cause: concept gap

Correction

DNA is chemically less reactive and structurally more stable than RNA because RNA's 2'-OH group is reactive and RNA is also catalytic; the presence of thymine instead of uracil confers additional stability to DNA, making DNA the preferred molecule for storage of genetic information.

Wrong option pattern

claims RNA is more stable than DNA or that thymine is less stabilising than uracil

Mistake

Computes p² + q² = 1 forgetting the 2pq heterozygote term.

Root cause: formula misuse

Correction

Genotype frequencies: p² (AA) + 2pq (Aa) + q² (aa) = 1. Allele frequencies: p + q = 1. Don't drop 2pq.

Mistake

Students classify Down's syndrome or Turner's syndrome as a Mendelian disorder because it is 'genetic', instead of recognising it as a chromosomal disorder.

Root cause: concept gap

Correction

Mendelian disorders (e.g. haemophilia, cystic fibrosis, sickle-cell anaemia, colour blindness, phenylketonuria, thalassemia) are caused by alteration/mutation in a single gene and are traced by pedigree analysis, whereas chromosomal disorders are caused by absence, excess or abnormal arrangement of whole chromosomes — this lesson covers only the Mendelian category.

Wrong option pattern

lists Down's syndrome or Turner's syndrome as an example of a Mendelian disorder

Mistake

Students assume a carrier mother of haemophilia or colour blindness must show some symptoms, missing that the recessive gene's effect is fully suppressed by the matching dominant normal gene.

Root cause: concept gap

Correction

The mother is not herself colour blind (or haemophilic) because the gene is recessive and its effect is suppressed by her matching dominant normal gene on the other X chromosome; she can still transmit the trait to sons with 50 per cent probability.

Wrong option pattern

claims a heterozygous carrier mother shows partial or mild symptoms of the disorder

Mistake

Calls a frameshift only when a multiple of 3 is added/deleted.

Root cause: concept gap

Correction

Frameshift = ANY indel NOT divisible by 3 (since codons are triplets). Indels of 3, 6, 9... preserve reading frame.

Mistake

Lists UGA as start codon (it's a stop codon).

Root cause: term confusion

Correction

Start codon: AUG (Met / fMet). Stop codons: UAA (ochre), UAG (amber), UGA (opal/umber).

Formulas in this unit

Hardy-Weinberg equation

p^{2} + 2 pq + q^{2} = 1

In an idealised population (no mutation, drift, selection, gene flow, random mating), allele and genotype frequencies remain constant.

Symbol	Quantity	SI Unit
p	freq of dominant allele A	-
q	freq of recessive allele a	-

Valid when

Idealised population
All five conditions met
Diploid, autosomal, biallelic locus